ID: 1162765728_1162765740

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1162765728 1162765740
Species Human (GRCh38) Human (GRCh38)
Location 19:12918394-12918416 19:12918424-12918446
Sequence CCCTCCTGCCGACCCTTCAACCC CTCGATGTGCTGCTGCGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 242} {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!