ID: 1162765732_1162765745

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1162765732 1162765745
Species Human (GRCh38) Human (GRCh38)
Location 19:12918402-12918424 19:12918446-12918468
Sequence CCGACCCTTCAACCCTGGTCACC GTGGGGACCCGCAGGAAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 254} {0: 1, 1: 0, 2: 2, 3: 14, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!