ID: 1162765734_1162765746

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162765734 1162765746
Species Human (GRCh38) Human (GRCh38)
Location 19:12918407-12918429 19:12918447-12918469
Sequence CCTTCAACCCTGGTCACCTCGAT TGGGGACCCGCAGGAAAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106} {0: 1, 1: 0, 2: 3, 3: 14, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!