ID: 1162799463_1162799476

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1162799463 1162799476
Species Human (GRCh38) Human (GRCh38)
Location 19:13102878-13102900 19:13102915-13102937
Sequence CCTGATAAGGAGCCTGGCTGACC CGGGCGGGGACCTAGCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118} {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!