ID: 1162799466_1162799478

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1162799466 1162799478
Species Human (GRCh38) Human (GRCh38)
Location 19:13102890-13102912 19:13102924-13102946
Sequence CCTGGCTGACCCCGGAGGAAACC ACCTAGCAGCGCGGGCCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116} {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!