ID: 1162799471_1162799477

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1162799471 1162799477
Species Human (GRCh38) Human (GRCh38)
Location 19:13102900-13102922 19:13102916-13102938
Sequence CCCGGAGGAAACCAGCGGGCGGG GGGCGGGGACCTAGCAGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 101} {0: 1, 1: 1, 2: 2, 3: 12, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!