ID: 1162799471_1162799481

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162799471 1162799481
Species Human (GRCh38) Human (GRCh38)
Location 19:13102900-13102922 19:13102940-13102962
Sequence CCCGGAGGAAACCAGCGGGCGGG CTCCCGGCCCCGCCCCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 101} {0: 1, 1: 2, 2: 18, 3: 120, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!