ID: 1162914111_1162914131

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162914111 1162914131
Species Human (GRCh38) Human (GRCh38)
Location 19:13865295-13865317 19:13865348-13865370
Sequence CCCCGCCCACGGCCTAGGGAGCC ATTTCCCGTGCAGGCGCCTCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!