ID: 1162914132_1162914142

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1162914132 1162914142
Species Human (GRCh38) Human (GRCh38)
Location 19:13865352-13865374 19:13865370-13865392
Sequence CCCGTGCAGGCGCCTCGGGCCCG GCCCGGGGGGCTTTTCCGGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!