ID: 1162914132_1162914153

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1162914132 1162914153
Species Human (GRCh38) Human (GRCh38)
Location 19:13865352-13865374 19:13865401-13865423
Sequence CCCGTGCAGGCGCCTCGGGCCCG AAGAAGAGGGGGAAATGCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 37, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!