ID: 1163228025_1163228035

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1163228025 1163228035
Species Human (GRCh38) Human (GRCh38)
Location 19:15978922-15978944 19:15978968-15978990
Sequence CCAGATCCCGTGCCTTTGGGTGA TTGAATCTCAAGGGTCAAAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 4, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!