ID: 1163228161_1163228167

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163228161 1163228167
Species Human (GRCh38) Human (GRCh38)
Location 19:15979545-15979567 19:15979571-15979593
Sequence CCAAGAGAACCTGCTACCAGAGT GGTCTCGTGTTCAGCCAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!