ID: 1163228163_1163228169

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1163228163 1163228169
Species Human (GRCh38) Human (GRCh38)
Location 19:15979554-15979576 19:15979580-15979602
Sequence CCTGCTACCAGAGTGTAGGTCTC TTCAGCCAGGGAGGCAGTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 30, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!