ID: 1163436131_1163436136

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1163436131 1163436136
Species Human (GRCh38) Human (GRCh38)
Location 19:17296295-17296317 19:17296329-17296351
Sequence CCTTCCACCTTGGCCTTCCAAAG TAGATATGAGCCACTGTGCCCGG
Strand - +
Off-target summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!