ID: 1163586922_1163586943

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1163586922 1163586943
Species Human (GRCh38) Human (GRCh38)
Location 19:18169273-18169295 19:18169326-18169348
Sequence CCCGCCGCCTGCCGCCCGCTGAG CCTGGGCCCGTCTGCGCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 328} {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!