ID: 1163586923_1163586939

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1163586923 1163586939
Species Human (GRCh38) Human (GRCh38)
Location 19:18169274-18169296 19:18169323-18169345
Sequence CCGCCGCCTGCCGCCCGCTGAGC GCCCCTGGGCCCGTCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 339} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!