ID: 1163586927_1163586945

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1163586927 1163586945
Species Human (GRCh38) Human (GRCh38)
Location 19:18169284-18169306 19:18169332-18169354
Sequence CCGCCCGCTGAGCACCGAGGACC CCCGTCTGCGCCGGAGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100} {0: 1, 1: 0, 2: 9, 3: 483, 4: 16256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!