ID: 1163586929_1163586939

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1163586929 1163586939
Species Human (GRCh38) Human (GRCh38)
Location 19:18169288-18169310 19:18169323-18169345
Sequence CCGCTGAGCACCGAGGACCCGCC GCCCCTGGGCCCGTCTGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!