ID: 1163586936_1163586947

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1163586936 1163586947
Species Human (GRCh38) Human (GRCh38)
Location 19:18169310-18169332 19:18169335-18169357
Sequence CCCAAGCAGAGCCGCCCCTGGGC GTCTGCGCCGGAGGCTGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 178} {0: 1, 1: 0, 2: 3, 3: 34, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!