ID: 1163586938_1163586948

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163586938 1163586948
Species Human (GRCh38) Human (GRCh38)
Location 19:18169321-18169343 19:18169338-18169360
Sequence CCGCCCCTGGGCCCGTCTGCGCC TGCGCCGGAGGCTGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 290} {0: 1, 1: 1, 2: 5, 3: 153, 4: 2564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!