ID: 1163586946_1163586951

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1163586946 1163586951
Species Human (GRCh38) Human (GRCh38)
Location 19:18169333-18169355 19:18169347-18169369
Sequence CCGTCTGCGCCGGAGGCTGCGGC GGCTGCGGCGGCGGGAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 368, 4: 13919} {0: 1, 1: 1, 2: 5, 3: 94, 4: 882}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!