ID: 1163635574_1163635585

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1163635574 1163635585
Species Human (GRCh38) Human (GRCh38)
Location 19:18435736-18435758 19:18435774-18435796
Sequence CCGCGCCCGCGCCCCACGCACGC CGCCGGGCGTATAGAGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 90, 4: 540} {0: 1, 1: 0, 2: 0, 3: 1, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!