ID: 1163755929_1163755946

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1163755929 1163755946
Species Human (GRCh38) Human (GRCh38)
Location 19:19106143-19106165 19:19106186-19106208
Sequence CCTCGTGTTCCTCGGTCCCCACC GACGTGCGGGTGCTCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!