ID: 1163804132_1163804142

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1163804132 1163804142
Species Human (GRCh38) Human (GRCh38)
Location 19:19385941-19385963 19:19385965-19385987
Sequence CCGCCGCCCGAGCGCGCCCCGCG CGCCCGCGCAGTCGGTCGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 409} {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!