ID: 1163804135_1163804142

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1163804135 1163804142
Species Human (GRCh38) Human (GRCh38)
Location 19:19385948-19385970 19:19385965-19385987
Sequence CCGAGCGCGCCCCGCGCCGCCCG CGCCCGCGCAGTCGGTCGGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 111, 4: 647} {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!