ID: 1164007988_1164007994

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1164007988 1164007994
Species Human (GRCh38) Human (GRCh38)
Location 19:21169495-21169517 19:21169514-21169536
Sequence CCTAGGGTGATGGAATGCCCTCT CTCTGGGTTTGTAGTGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 3, 3: 35, 4: 107} {0: 5, 1: 10, 2: 18, 3: 32, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!