ID: 1164117257_1164117262

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164117257 1164117262
Species Human (GRCh38) Human (GRCh38)
Location 19:22234567-22234589 19:22234606-22234628
Sequence CCAGTAACAGGCCAAGAGTTGTC GTTATCTGCAGAAAATGGCAGGG
Strand - +
Off-target summary {0: 17, 1: 171, 2: 183, 3: 131, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!