ID: 1164117259_1164117263

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1164117259 1164117263
Species Human (GRCh38) Human (GRCh38)
Location 19:22234578-22234600 19:22234628-22234650
Sequence CCAAGAGTTGTCTCTCAAAAGGA GCTTTGCTCCAAAATCCTAGAGG
Strand - +
Off-target summary {0: 17, 1: 200, 2: 191, 3: 170, 4: 310} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!