ID: 1164179650_1164179665

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1164179650 1164179665
Species Human (GRCh38) Human (GRCh38)
Location 19:22807510-22807532 19:22807549-22807571
Sequence CCCGCGCGGCTCTGTGGCCCGGG GCCCACGACGGCCACCGGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!