ID: 1164288326_1164288329

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1164288326 1164288329
Species Human (GRCh38) Human (GRCh38)
Location 19:23842513-23842535 19:23842551-23842573
Sequence CCACTTGCTAAATATGTGTGTTT AATGTTAACTTTCAAGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 49, 4: 455} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!