ID: 1164512866_1164512869

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1164512866 1164512869
Species Human (GRCh38) Human (GRCh38)
Location 19:28911804-28911826 19:28911826-28911848
Sequence CCGCAACAAATGCGCAGCCTAAA AATCATCTCCCAGCCCACCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!