ID: 1164636087_1164636098

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1164636087 1164636098
Species Human (GRCh38) Human (GRCh38)
Location 19:29792450-29792472 19:29792499-29792521
Sequence CCTGCACACTGAACTCTGCTTTC TGTGCCTCCATTCCAGGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!