ID: 1164648105_1164648117

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1164648105 1164648117
Species Human (GRCh38) Human (GRCh38)
Location 19:29873628-29873650 19:29873665-29873687
Sequence CCCGGCCCCGCGCCCTCCCGGCC CGTCTGCTGCCATCTGGTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 24, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!