ID: 1165146526_1165146533

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1165146526 1165146533
Species Human (GRCh38) Human (GRCh38)
Location 19:33734610-33734632 19:33734632-33734654
Sequence CCATCGTTGTCCCAACTGCAGGA AGCTCAGGGAGAGGAGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 116, 4: 1007}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!