ID: 1165156694_1165156701

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1165156694 1165156701
Species Human (GRCh38) Human (GRCh38)
Location 19:33793085-33793107 19:33793102-33793124
Sequence CCCTTTAGTCTCCAGATTCTCTG TCTCTGGGGTCCTAACTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 238} {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!