ID: 1165285593_1165285598

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1165285593 1165285598
Species Human (GRCh38) Human (GRCh38)
Location 19:34839121-34839143 19:34839141-34839163
Sequence CCCCAGCAGGGGACTCTCGAGCT GCTTCGGGATTCCGCCTACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!