ID: 1165479495_1165479509

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1165479495 1165479509
Species Human (GRCh38) Human (GRCh38)
Location 19:36054288-36054310 19:36054330-36054352
Sequence CCCCGCCCCACCCGCGCTCGCCG GTGGAGTCTCGTCACGTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 522} {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!