ID: 1165479497_1165479510

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1165479497 1165479510
Species Human (GRCh38) Human (GRCh38)
Location 19:36054290-36054312 19:36054331-36054353
Sequence CCGCCCCACCCGCGCTCGCCGCC TGGAGTCTCGTCACGTACCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 74, 4: 839} {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!