ID: 1165479498_1165479509

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1165479498 1165479509
Species Human (GRCh38) Human (GRCh38)
Location 19:36054293-36054315 19:36054330-36054352
Sequence CCCCACCCGCGCTCGCCGCCTGC GTGGAGTCTCGTCACGTACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 337} {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!