ID: 1165496138_1165496142

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1165496138 1165496142
Species Human (GRCh38) Human (GRCh38)
Location 19:36152675-36152697 19:36152706-36152728
Sequence CCCAAAGCGGTACCAGGGAATAC AGATTTTTGGAGATTTCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!