ID: 1165924888_1165924899

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1165924888 1165924899
Species Human (GRCh38) Human (GRCh38)
Location 19:39320808-39320830 19:39320832-39320854
Sequence CCCGGGCCCGGCCCCGCCGCCGC GCCTCGCTCCGCGCCATGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!