ID: 1165924888_1165924902

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1165924888 1165924902
Species Human (GRCh38) Human (GRCh38)
Location 19:39320808-39320830 19:39320834-39320856
Sequence CCCGGGCCCGGCCCCGCCGCCGC CTCGCTCCGCGCCATGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 45, 3: 362, 4: 2016} {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!