ID: 1165924892_1165924911

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1165924892 1165924911
Species Human (GRCh38) Human (GRCh38)
Location 19:39320819-39320841 19:39320846-39320868
Sequence CCCCGCCGCCGCTGCCTCGCTCC CATGGTGGGGGGAGGGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 66, 4: 523} {0: 1, 1: 0, 2: 6, 3: 65, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!