ID: 1165924892_1165924918

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1165924892 1165924918
Species Human (GRCh38) Human (GRCh38)
Location 19:39320819-39320841 19:39320865-39320887
Sequence CCCCGCCGCCGCTGCCTCGCTCC GGGGAGGGGGCGCGGTGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 66, 4: 523} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!