ID: 1165924893_1165924914

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1165924893 1165924914
Species Human (GRCh38) Human (GRCh38)
Location 19:39320820-39320842 19:39320851-39320873
Sequence CCCGCCGCCGCTGCCTCGCTCCG TGGGGGGAGGGCCGGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 312} {0: 1, 1: 3, 2: 22, 3: 332, 4: 3032}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!