ID: 1165924894_1165924916

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1165924894 1165924916
Species Human (GRCh38) Human (GRCh38)
Location 19:39320821-39320843 19:39320857-39320879
Sequence CCGCCGCCGCTGCCTCGCTCCGC GAGGGCCGGGGGAGGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 82, 4: 555} {0: 1, 1: 5, 2: 43, 3: 515, 4: 3786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!