ID: 1166137568_1166137576

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1166137568 1166137576
Species Human (GRCh38) Human (GRCh38)
Location 19:40786636-40786658 19:40786676-40786698
Sequence CCCTGACCTCAGAGTGTGTGCCC CTGGAGACCAGCGCTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221} {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!