ID: 1166446988_1166446990

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1166446988 1166446990
Species Human (GRCh38) Human (GRCh38)
Location 19:42866615-42866637 19:42866643-42866665
Sequence CCATCTTCTCTGCAAACACACAG ATCTCTGTGTTCATTTCTATTGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 5, 3: 68, 4: 600} {0: 7, 1: 3, 2: 7, 3: 72, 4: 690}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!