ID: 1166446988_1166446992

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1166446988 1166446992
Species Human (GRCh38) Human (GRCh38)
Location 19:42866615-42866637 19:42866660-42866682
Sequence CCATCTTCTCTGCAAACACACAG TATTGGGAGCCCTGTATGCAAGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 5, 3: 68, 4: 600} {0: 5, 1: 1, 2: 1, 3: 19, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!