ID: 1166466181_1166466184

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1166466181 1166466184
Species Human (GRCh38) Human (GRCh38)
Location 19:43032837-43032859 19:43032866-43032888
Sequence CCATCTTCTCTGCAAACACACAG TCTCTGTGTTCATTTCTATTGGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 5, 3: 68, 4: 600} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!